The Role and Mechanism of Nicotinamide Riboside in Oxidative Damage and a Fibrosis Model of Trabecular Meshwork Cells

Abstract

Purpose: To investigate the potential effects and mechanism of nicotinamide riboside (NR) on the oxidative stress and fibrosis model of human trabecular meshwork (HTM) cell line cells.

Methods: HTM cells were pretreated with NR, followed by the induction of oxidative injury and fibrosis by hydrogen peroxide (H₂O₂) and TGF-β2, respectively. Cell viability was tested using Hoechst staining and MTT assays, cell proliferation was assessed by EdU assay, and cell apoptosis was detected by flow cytometry and western blotting. DCFH-DA and DHE probes were used to measure the level of reactive oxygen species (ROS), and MitoTracker staining was used to measure the mitochondrial membrane potential (MMP). Fibrotic responses, including cell migration and deposition of extracellular matrix (ECM) proteins, were detected via Transwell assays, qRT-PCR, and immunoblotting.

Results: NR pretreatment improved the viability, proliferation, and MMP of H₂O₂-treated HTM cells. Compared to cells treated solely with H₂O₂, HTM cells treated with both NR and H₂O₂, exhibited a reduced rate of apoptosis and generation of ROS. Compared with H₂O₂ pretreatment, NR pretreatment upregulated expression of the JAK2/Stat3 pathway but inhibited mitogen-activated protein kinase (MAPK) pathway expression. Moreover, 10-ng/mL TGF-β2 promoted cell proliferation and migration, which were inhibited by NR pretreatment. Both qRT-PCR and immunoblotting showed that NR inhibited the expression of fibronectin in a TGF-β2–induced fibrosis model.

Conclusions: NR has a protective effect on oxidative stress and fibrosis in HTM cells, which may be related to the JAK2/Stat3 pathway and MAPK pathway.

Translational Relevance: Our research provides the ongoing data for potential therapy of NAD⁺ precursors in glaucoma.

Introduction

Glaucoma is the second leading cause of blindness globally.¹ Given the increase in the number and proportion of elderly people in the broader population, it is estimated that 111.8 million people will have glaucoma by 2040.² Elevated intraocular ocular pressure (IOP)-related factors are thought to be the only modifiable risk factors contributing to glaucoma progression. Surgical, laser therapy, and ocular hypotensive therapy are proven and generally accepted treatments that can delay glaucoma progression.^3,4 Drugs used to lower IOP, such as carbonic anhydrase inhibitors, have concomitant side effects, including blurred vision, ocular discomfort, and taste perversion.^5,6 

Although glaucoma could develop under normal IOP (namely, normal tension glaucoma), IOP elevation has been considered as an important risk factor and the only controllable factor for glaucoma. The dynamic balance of IOP is stabilized by aqueous humor (AH) production and outflow, and if the channel through which AH outflow is obstructed it will cause raised IOP and resultant visual field defects.⁷ The trabecular meshwork (TM) is a vital outflow channel of AH that is involved in the pathogenesis of glaucoma.⁸ The TM is a type of tissue that promotes proliferation, migration, adhesion, phagocytosis, and secretion.⁹ Abnormal TM function can result in reduced AH outflow, which in turn causes increased IOP. Herein, we used human trabecular meshwork (HTM) cell lines, which have been widely used for glaucoma research, as in vitro models.¹⁰ 

Mounting evidence has shown that oxidative stress plays a critical role in the progression of glaucoma.¹¹ Glaucoma-affected TM cells exhibit oxidative stress, mitochondrial defects, and apoptosis.⁹ For example, AH contains several active oxidative agents, including superoxide anions and hydrogen peroxide (H₂O₂), and TM cells are constantly exposed to oxidative stress in the AH pathway.^12,13 Although TM cells have an antioxidant defense against oxidative injury, when the production and scavenging of free radicals are imbalanced, free radicals accumulate excessively in the cell, which in turn causes cell damage.^14,15 Moreover, Amankwa et al.¹⁶ reported that the levels of reactive oxygen species (ROS) in the TM of patients with primary open-angle glaucoma were significantly greater. Apart from oxidative stress, numerous studies have shown that transforming growth factor-beta 2 (TGF-β2), a profibrotic cytokine, is also a major contributor to glaucomatous TM dysfunction.^17,18 As a member of the TGF-β superfamily, TGF-β2 can upregulate extracellular matrix (ECM) production in the TM, resulting in IOP elevation. Furthermore, research has shown that TGF-β2 can lead to oxidative stress in HTM cells, and the use of mitochondrial-targeted antioxidants may delay TGF-β2–induced profibrotic responses in the trabecular meshwork.¹⁹ Interestingly, recent studies revealed the IOP-lowering effect of Rho kinase inhibitors by regulating cytoskeleton, relaxing TM tissue, and preventing fibrotic responses.^20–22 Several Rho kinase inhibitors have been approved to treat glaucoma, including ripasudil (K-115) and netarsudil (AR-13324) in Japan and the United States, respectively.²² Therefore, antiapoptosis and antifibrosis are two essential targets for maintaining functional TM, suggesting the need for novel antiglaucoma drugs. 

Nicotinamide riboside (NR), a widely used health supplement, is a natural nutrient that exists in the human diet and that is found in products such as milk.²³ NR is not toxic, has membrane permeability, is easily taken up by cells, and is not easily inactivated by serum hydrolases.²⁴ Current research on NR has focused on its neuroprotective effects on glaucoma,²⁵ but there have been no studies on its antioxidant and antifibrotic effects on TM cells. Increasing evidence²⁶ indicates that NR increases intracellular nicotinamide adenine dinucleotide (NAD⁺) levels in cells, consequently enhancing mitochondrial protection to prevent oxidative diseases and fibrosis. Our previous study showed that NR alleviated the oxidative damage of H₂O₂-treated human lens epithelial cells.²⁷ Additionally, Jiang et al.²⁸ reported that NR attenuates the development of liver fibrosis. Accordingly, we propose that NR may be used as a potential therapeutic agent for glaucoma by inhibiting oxidative damage and fibrosis in TM cells. 

In this paper, we present the findings of our study in which H₂O₂ and TGF-β2 were used to induce oxidative damage and fibrosis in HTM cells cultured in vitro. Our objective was to observe the effects of NR treatment on mitochondria and H₂O₂-induced proliferation, apoptosis, and ROS and to further explore the possible mechanism of action while also investigating the antifibrotic effect of NR. 

Materials and Methods

Cell Culture and Treatment

HTM cells were purchased from Meisen Chinese Tissue Culture Collections (Zhejiang, China). The cells were cultured in Dulbecco's Modified Eagle Medium (DMEM)/Nutrient Mixture F-12 medium (L310KJ; BasalMedia, Shanghai, China) containing 15% fetal bovine serum and supplemented with 1% penicillin–streptomycin (GA3502; GeneView, Beijing, China). Cultures were maintained at 37°C with 5% CO₂. HTM cells were verified by detecting the expression of myocilin after treatment with 100-nM dexamethasone (HY-14648; MedChemExpress, Monmouth Junction, NJ) for 5 days.^29,30 The cells were treated as follows: for the control (CON), NR, H₂O₂, and TGF-β2 groups, HTM cells were incubated with culture medium, 1-mM NR (S31692; Shanghai Yuanye Bio-Technology, Shanghai, China), 200-µM H₂O₂ (E882, AMRESCO, Solon, OH), and 10-ng/mL TGF-β2 (Z03429-50; GenScript, Jiangsu, China), respectively, for 48 hours. For the NR+H₂O₂ group, cells were pretreated with 1-mM NR for 24 hours and then incubated with 200-µM H₂O₂ for another 24 hours. For the TGF-β2+NR group, cells were treated with 10-ng/mL TGF-β2 and 1-mM NR for 48 hours simultaneously. H₂O₂ and NR were diluted in the medium to reach the final concentrations. 

Cell Viability Analysis

We used the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay (40201ES80; Yeasen Biotechnology, Shanghai, China) to detect cell viability after seeding in 96-well plates at 5 × 10³ cells per well. The HTM cells were treated with different concentrations of H₂O₂ (0, 100, 200, 400, 600, 800, and 1000 µM) or TGF-β2 (0, 2.5, 5, 7.5, 10, and 12.5 ng/mL) for different lengths of time (6, 12, and 24 hours or 24 and 48 hours). Then, 0.5 mg/mL MTT was added in culture medium for 4 hours at 37°C and further dissolved with dimethyl sulfoxide (DMSO). Each group with more than three replicates was measured by a microplate reader (Thermo Fisher Scientific, Waltham, MA) with absorbance at 570 nm. The results were normalized to the control. 

EdU Assay

Proliferation of HTM cells was detected by using BeyoClick EdU Cell Proliferation Kit (C0071S; Beyotime, Shanghai, China) according to the manufacturer's protocols. HTM cells were cultured and treated in 96-well plates at 5 × 10³ cells per well (three replicates for each group). Briefly, 10-µM EdU was added followed by incubation for 12 hours at 37°C. After cells were fixed with 4% paraformaldehyde for 15 minutes, they were permeabilized with 0.3% Triton X-100 in PBS. Nuclei were dyed with Hoechst 33342 solution (B804; Solarbio, Beijing, China) and captured by a high-content imaging analysis system at 100× magnification. Calculation of the percentage of EdU-positive cells was performed using ImageJ (National Institutes of Health, Bethesda, MD). 

Determination of Apoptosis

Cell apoptosis levels were determined using an APC Annexin V Apoptosis Detection Kit with 7-ADD (640930; BioLegend, San Diego, CA) following the manufacturer's directions. HTM cells were seeded in six-well plates and treated as before. After collecting and resuspending the samples in 100-µL Binding Buffer, a volume of 5-µL APC Annexin V and 5-µL 7-AAD was added to the sample, which was mixed well and then incubated in the dark for 15 minutes. Then, 300-µL Binding Buffer was added to the samples before they were loaded on the machine. The samples were then transferred to a flow tube and detected using the FACSCanto II system (BD Biosciences, Franklin Lakes, NJ). FlowJo software was used to analyze the data. 

Mitochondrial Membrane Potential Assay

HTM cells were seeded on 24-well plates at a density of 3 × 10⁴ cells per well and treated as described above. The mitochondrial membrane potential (MMP) was determined by using a MitoTracker (C1035; Beyotime) in accordance with the manufacturer's instructions. 

Cellular ROS Measurement

Cellular ROS was measured by Dichlorodihydrofluorescein diacetate (DCFH-DA, CA1410; Solarbio). After the appropriate treatment period, HTM cells were treated with 10-µM DCFH-DA for 30 minutes in the medium. Incubated cells were washed three times with PBS, Finally, the 2′,7′-dichlorodihydrofluorescein (DCF) fluorescence was obtained using a fluorescence microscope (Leica, Wetzlar, Germany). 

Dihydroethidium Staining

HTM cells were processed as described above and then probed with dihydroethidium (DHE, S0063; Beyotime) at 37°C for 30 minutes, and the nuclei were stained with Hoechst 33342. After washing with PBS for three times, they were examined under the Leica fluorescence microscope. 

Protein Whole Cell Lysate and Western Blots

The HTM cells were treated as described before. The protein was then extracted from HTM cells in NP40 lysis buffer supplement (P0013F; Beyotime) with the proteinase inhibitor phenylmethylsulfonyl fluoride (PMSF) and phosphatase inhibitor PhosSTOP (Roche, Basel, Switzerland). A BCA Protein Assay Kit (GK10009; GlpBio Technology, Montclair, CA) was used to quantitatively determine the protein concentration. The proteins were diluted in 4× loading buffer and denatured at 98°C for 10 minutes. Then, 30 to 60 µg of proteins were separated on 10% or 12% sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS‑PAGE) and transferred onto appropriate polyvinylidene fluoride (PVDF) membranes. After they were blocked with 5% skim milk for 2 hours in order to block non-specific binding, the membranes were incubated with primary antibodies overnight. Antibodies for Bax, Bcl-2, and GAPDH were purchased from Abcam (ab32503, ab182858, ab8245, 1:1,000; Abcam, Cambridge, MA). Antibodies for p-P38, p-Stat3, Stat3, p-ERK1/2, p-JAK2, JAK2, and β-tubulin were obtained from Cell Signaling Technology (cst19211, cst19134, cst19101, cst12640, cst3771, cst3230, cst12146, 1:1,000; Cell Signaling Technology Danvers, MA). Antibodies for myocilin and P38 mitogen-activated protein kinase (MAPK) were obtained from ABclonal (A1589, A14401, 1:1,000; ABclonal Technology, Woburn, MA) and the antibody for ERK1/2 was obtained from Affinity (AF0155, 1:1,000; Affinity Biosciences, Cincinnati, OH). Antibodies for fibronectin (FN) were obtained from Santa Cruz Biotechnology (sc-8422, 1:1,000; Santa Cruz Biotechnology, Santa Cruz, CA). After washing with Tris-buffered saline with 0.1% Tween 20 (TBST) three times, the membrane was incubated with horseradish peroxidase (HRP)‑conjugated secondary antibodies. Immunoblotting signals were developed with an ECL Reagent Kit (36208ES76; Yeasen). Image J was used to analyze the gray value of each protein band. 

Real-Time PCR Analysis

In the TGF-β2 group, HTM cells were exposed to 10-ng/mL TGF-β2 for 48 hours; in the TGF-β2+NR group, cells were incubated with 10-ng/mL TGF-β2 and 1-mM NR for 48 hours. Total RNA was extracted following the manufacturer's instructions, and reverse transcription was carried out using the Magen HiPure Universal RNA Mini Kit (R4130; Guangzhou Angen Biotech, Guangdong, China). quantitative reverse transcription polymerase chain reaction (qRT-PCR) was performed using Taq SYBR Green Premix (QIAGEN, Hilden, Germany). The relative mRNA expression was determined using the ΔΔC_T method and GAPDH primer pairs were used as a reference control. Primer sequences were as follows: FN sense, AGACCAGCAGAGGCATAAGG, antisense, CCACTCATCTCCAACGGCATA; GAPDH sense, CGAHATCCCTCCAAAATCAA, antisense, GTCTTCTGGGTGGCAGTGA. 

Migration Assay

Cell migration assays were implemented in Transwell chambers (24-well, 14311; LabSelect, Beijing, China), and 2 × 10⁴ cells were seeded in the upper chamber with 200 µL DMEM/F-12 serum-free medium. Then, 600 µL of complete culture medium with or without TGF-β2 and/or NR was added in the lower chamber. After 48 hours, cells on the membrane were fixed with methanol and stained with 0.1% crystal violet for 15 minutes. Four randomly selected areas were calculated for each well. 

Statistics

Data were statistically analyzed using GraphPad Prism 8.0 software. All experiments described were performed at least 3 independent times (n ≥ 3), with more than 3 technical replicates for each group. Data are mean ± standard deviation. Differences among groups were performed by one-way analysis of variance (ANOVA), student t test was used for 2-group comparison. P-value < 0.05 was considered statistically significant. 

Results

Effect of H₂O₂ on the Proliferation of HTM Cells

HTM cells were verified by the positive expression of myocilin after dexamethasone treatment (Supplementary Fig. S1). It is known from the most recent literature that H₂O₂-induced oxidative damage can lead to a reduction in cell viability in a dose-dependent manner.^31,32 For this reason, we explored whether H₂O₂ can induce the death of HTM cells. HTM cells were treated with different concentrations of H₂O₂ (0, 100, 200, 400, 600, 800, or 1000 µM) for different lengths of time (6, 12, and 24 hours). It was found by MTT assay that H₂O₂ significantly decreased cell viability in a dose-dependent manner (Figs. 1A–1C), particularly in cells exposed to 200-µM H₂O₂ at 24 hours. Furthermore, cell nuclei were stained with Hoechst 33342 to investigate the effect of 200-µM H₂O₂ on HTM cell survival. From the results, it can be seen that the number of nuclei of HTM cells incubated with 200-µM H₂O₂ was significantly reduced compared with the CON group (Figs. 1D, 1E). Based on this finding, the use of 200-µM H₂O₂ for 24 hours is proposed as an oxidative damage model of HTM cells in vitro. 

Figure 1.

 

H₂O₂ inhibited the proliferation of HTM cells. (A–C) HTM cells were exposed to various concentrations of H₂O₂ (0, 100, 200, 400, 600, 800, and 1000 µM) for 6, 12, and 24 hours. The results showed that the proliferation of HTM cells decreased in a concentration-dependent and time-dependent manner (n = 5). (D, E) Nuclei labeled with Hoechst 33342 showed cell survival (n = 4). Scale bar: 50 µm ^**P < 0.01 and ^***P < 0.001 versus the CON group; n.s., no significance. Results are shown as mean ± SD.

NR Treatment Protects HTM Cell Survival Against Oxidative Stress

Given that the nucleoside analog EdU is present throughout cell cultures,³³ we intended to use the EdU assay and MTT assay to assess whether NR has an effect on HTM cell proliferation under oxidative stress. As shown in Figures 2A to 2C, NR pretreatment successfully increased the viability of HTM cells compared with that of the H₂O₂ group at 24 hours, suggesting that NR promoted HTM cells proliferation under oxidative stress. When we further investigated the effect of NR on apoptosis of oxidative-damaged HTM cells, apoptotic cells were identified using the APC Annexin V Apoptosis Detection Kit with 7-AAD and were evaluated by flow cytometry. Based on the results (Fig. 2D), H₂O₂-treated HTM cells had more apoptotic cells than did the control cells, whereas after NR intervention the apoptotic levels of HTM cells decreased significantly. In addition, the NR intervention enhanced the level of the antiapoptotic protein Bcl-2 and inhibited the expression of apoptotic protein Bax, indicating that NR strengthens the antiapoptotic ability of HTM cells (Figs. 2E–2G). 

Figure 2.

 

NR inhibited HTM cell survival from oxidative stress. (A, B) EdU assay showed that H₂O₂ reduced the positive rate of EdU in HTM cells, whereas NR pretreatment significantly increased the positive rate of EdU in cells (n = 4). Scale bar: 50 µm. (C) MTT assay revealed that NR promoted the proliferation of oxidative-damaged HTM cells (n = 5). (D) Flow cytometry analysis revealed that NR restrained H₂O₂-induced apoptosis in HTM cells. (E–G) The results of western blot indicated that NR markedly upregulated the expression of the antiapoptotic protein Bcl-2 but inhibited the expression of apoptotic protein Bax (n = 3). ^**P < 0.01 and ^***P < 0.001 versus the CON group; ⁺P < 0.05, ⁺⁺P < 0.01, and ⁺⁺⁺P < 0.001 versus the H₂O₂ group. Results are shown as mean ± SD.

Effects of NR Treatment on Oxidative-Damaged HTM Cells

Oxidative damage may lead to higher production of ROS and superoxide anions, and we used DCFH-DA and DHE probes to detect it. Under a fluorescence microscope (Fig. 3A), results showed that NR dramatically decreased the green fluorescence intensity in H₂O₂-treated cells, indicating that NR was able to inhibit ROS generation in HTM cells. Comparable outcomes were noted for the DHE staining (Fig. 3C), with the NR+H₂O₂ group exhibiting a marked decrease in red fluorescence intensity compared to the H₂O₂ group. These findings indicate that NR may shield HTM cells from oxidative stress by lowering ROS and superoxide anion levels. 

Figure 3.

 

NR repressed the accumulation of intracellular ROS and superoxide anion in HTM cells under oxidative stress. (A, B) ROS production was detected by DCFH-DA staining. Normally, only a few cells showed weak green fluorescence. In the H₂O₂ group, the green fluorescence was obviously enhanced. Although the green fluorescence intensity was reduced in the NR+H₂O₂ group (n = 4). Scale bar: 50 µm. (C, D) Intracellular superoxide anion levels were analyzed using DHE staining. DHE fluorescence was markedly decreased after NR intervention (n = 4). Scale bar: 50 µm. ^***P < 0.001 versus the CON group; ⁺⁺P < 0.01 and ⁺⁺⁺P < 0.001 versus the H₂O₂ group. Results are shown as mean ± SD.

Additionally, mitochondria are important source of ROS production, and NR has been found to be closely associated with mitochondrial structure and function. Therefore, we stained the mitochondria of HTM cells with MitoTracker Red CMXRos, and the red fluorescence intensity represented MMP levels. As shown in Figure 4, the results indicate that most of the cells in the CON group expressed red fluorescence, which was decreased after H₂O₂ treatment, and this phenomenon could be alleviated after NR intervention, suggesting that NR can reduce the destruction of MMP by oxidative damage. 

Figure 4.

 

NR increased the MMP in oxidative-damaged HTM cells. (A) Images of mitochondria stained with MitoTracker (red) and nuclei probed with Hoechst 33342 (blue) (n = 4). Scale bar: 50 µm. (B) Relative fluorescence intensity analysis. H₂O₂ resulted in a reduction in MMP levels, but the MMP improved in the NR+H₂O₂ group. ^***P < 0.001 versus the CON group; ⁺⁺⁺P < 0.001 versus the H₂O₂ group. Results are shown as mean ± SD.

Effects of NR Treatment on the Signaling Pathway in H₂O₂-Exposed HTM Cells

To further investigate the potential molecular mechanisms involved in the protective effect of NR on oxidative-damaged HTM cells, we explored alterations in phosphorylated protein levels in the JAK2/Stat3 and MAPK pathways (Fig. 5). The results show that, in the MAPK pathway, H₂O₂ significantly reduced the p-P38/P38 ratio and increased the p-ERK1/2 protein expression levels, which were reversed by intervention with NR. In the JAK2/Stat3 pathway, H₂O₂ induced downregulation of p-JAK2 protein expression, which increased after NR intervention. 

Figure 5.

 

Representative western blot of MAPK and JAK2/Stat3 pathway proteins. (A) Western blot protein bands (n = 3). (B, D, E) The NR+H₂O₂ group promoted phosphorylation of P38 MAPK (B), JAK2 (D), and Stat3 (E) compared with H₂O₂ group. (C) The relative expression of p-ERK1/2 was downregulated after pretreatment with NR. NR increased the H₂O₂-induced MAPK and JAK2 activation of the pathway but decreased activation of the ERK1/2 pathway. ^*P < 0.05, ^**P < 0.01, and ^***P < 0.001 versus the CON group; ⁺⁺⁺P < 0.001 versus the H₂O₂ group; n.s., no significance. Results are shown as mean ± SD.

NR Attenuated TGF-β2–Induced ECM Expression in HTM Cells

To determine the concentrations of TGF-β2, MTT was used to assess the effect of different concentrations of TGF-β2 on HTM cell proliferation. The results found that HTM cells increased at a concentration of 10 ng/mL for 48 hours (Fig. 6A). Furthermore, the migration of HTM cells was also promoted after incubation with TGF-β2 (Figs. 6B, 6C). These results revealed that TGF-β2 induced the proliferation and migration of HTM cells. 

Figure 6.

 

NR attenuated TGF-β2–induced ECM deposition. (A) MTT results showed that the proliferation of HTM cells increased significantly at the concentration of 10 ng/mL for 48 hours (n = 5). (B, C) Transwell assay analysis revealed that TGF-β2 promoted HTM cell migration (n = 4). Scale bar: 50 µm. (D–F) NR decreased TGF-β2–induced ECM deposition (n = 3). (D) The relative mRNA expression levels of FN were significantly higher in the TGF-β2 group (compared to the CON group), and the increases were reduced by NR. (E, F) Similarly, TGF-β2 upregulated protein levels of FN in HTM cells, but the changes were attenuated in the NR+TGF-β2 group. ^**P < 0.01 and ^***P < 0.001 versus the CON group; ⁺⁺P < 0.01 versus the TGF-β2 group. Results are shown as mean ± SD.

Figure 7.

 

Antioxidant and antifibrotic effects of NR on HTM cells. The generation of ROS induced by H₂O₂ leads to mitochondrial damage of HTM cells, but NR can improve the MMP and reduce the number of apoptotic HTM cells, which may be related to the MAPK and JAK2/Stat3 signaling pathways. In addition, NR could attenuate TGF-β2–induced fibrosis of HTM cells.

Studies have confirmed that NR has an antifibrotic effect in different cells and tissues,^34,35 and we assessed whether NR inhibits ECM expression in TGF-β2–induced HTM cells. The results of qRT-PCR showed that the mRNA levels of FN increased in the TGF-β2 group, which was attenuated after incubation with NR (Fig. 6D). Similarly, TGF-β2 increased the protein levels of FN compared to the CON group, which was reversed by NR (Figs. 6E, 6F). These data suggest that NR has potential antifibrotic effects in HTM cells, but further experimental studies are necessary to explore its molecular mechanism. 

Discussion

Oxidative stress is believed to cause TM failure in glaucoma, and reduced TM cellularity can further contribute to tissue dysfunction issues, such as increased outflow resistance, which can cause ocular hypertension.¹⁴ Previous studies have shown that the TM is more susceptible to oxidative injury than other anterior ocular tissues.¹² Snider et al.³⁶ demonstrated that H₂O₂ causes a decrease in TM cell viability, leading to tissue dysfunction, manifested as decreased IOP homeostasis. Thus, we treated HTM cells with 200 µM H₂O₂ for 24 hours to construct an oxidative damage model. 

NR and nicotinamide (NAM) are two precursors of NAD⁺ that have been implicated in neurodegenerative diseases including Alzheimer's disease,³⁷ age-related macular degeneration,³⁸ and glaucoma.³⁹ When 1-mM NR was applied to various cell lines, it exhibited protective effects.^27,31,40 At present, regarding the application of NR in clinical practice, glaucoma patients can protect their optic nerves by taking 300 mg (approximately 1.18 mM) of NR orally.⁴¹ Oral intake of 1000 mg of NR (3.93 mM) is a potential neuroprotective therapy for patients with Parkinson's disease.⁴² Oral NR supplementation (1000 mg) in aged participants can increase the size of the skeletal muscle NAD⁺ metabolome.⁴³ However, the deleterious effects of such high concentrations of NR must be further investigated, and in vivo experiments are necessary to determine the effective concentrations of NR in the clinic. Emerging evidence has demonstrated the neuroprotective effects of NAM in retinal ganglion cells of glaucoma-prone mice through inhibiting oxidative stress.⁴⁴ Moreover, a crossover randomized clinical trial demonstrated that NAM supplementation improved the inner retinal function of patients with glaucoma.⁴⁵ In line with NAM, NR has also been shown to protect various other cell types from oxidative damage.^40,46 Our previous study²⁷ revealed that, after exposure to H₂O₂, NR-treated human lens epithelial cell lines (SRA01/04) exhibited increased survival. Meanwhile, systemic treatment with NR has been shown to protect retinal ganglion cells from the stress of elevated IOP and optic nerve crush.¹ Together, these studies suggest a key role for NAD⁺ in maintaining cellular homeostasis. However, the role of NAD⁺ precursor remains unclear in the injury of TM cells. 

Oxidative stress is an important pathogenic factor in glaucoma that triggers TM degeneration, which leads to intraocular hypertension.³⁶ An article by He et al.⁴⁷ showed that the TM of patients with glaucoma has higher endogenous ROS levels. Numerous studies have demonstrated that both endogenous and exogenous oxidative stress induced cell apoptosis by inducing intracellular NAD⁺ or adenosine triphosphate (ATP) depletion.^38,48,49 Our study constructed an in vitro oxidative injury model by supplementation with H₂O₂, which induced excessive generation of intracellular ROS and resulted in exogenous oxidative stress. Notably, NR and NAM have been highlighted for their antioxidant effects by improving mitochondrial homeostasis and maintaining oxidative phosphorylation.^40,46 Consistent with the findings of previous reports, our results showed that NR increased cell viability, inhibited cell apoptosis, and reduced cellular ROS in H₂O₂-treated HTM cells, indicating the protective effects of NR on TM cells against oxidative stress. ROS are the main cause of oxidative stress, and excessive ROS can damage mitochondria, rendering them dysfunctional, which in turn affects cell function.^50–52 NAD⁺ is an essential coenzyme for a variety of enzymes that participate in mitochondrial function, and NR can promote NAD⁺ supplementation in mitochondria.^40,53,54 Mitochondria are essential for eukaryotic life, but their function declines with age.⁵⁵ Our results showed that NR could significantly improve the H₂O₂-induced decrease in the MMP in HTM cells, indicating that NR may exert antioxidant effects by maintaining mitochondrial homeostasis. Because mitochondria are highly complex, further experiments are still required to reveal the protective effect conferred on mitochondria by NR in HTM cells. 

NR is involved in regulating multiple signaling pathways, such as oxidative stress,⁴⁰ the inflammatory response,⁴⁶ cellular aging,⁵⁶ autophagy,⁵⁷ and apoptosis.⁵⁸ It can play a therapeutic role in ocular diseases,³⁸ especially in glaucoma. Emerging evidence suggests that multiple signaling pathways, including the MAPK pathway, JAK/Stat pathway, and calcium–calpain pathway, are altered during the development of glaucoma.^59,60 Our findings suggest that the MAPK and JAK2/Stat3 pathways are associated with NR-alleviated HTM cell apoptosis during oxidative stress. 

TGF-β2 plays an important role in the pathological changes occurring in TM cells in primary open-angle glaucoma.¹⁷ We used MTT and Transwell assays to explore the effect of TGF-β2 on HTM cells. We found that TGF-β2 promoted HTM cell proliferation and migration, consistent with the findings of a previous study.⁶¹ Interestingly, apart from the antioxidant effect of NR, a previous study demonstrated that NR has an antifibrotic effect on different tissues and cells and that the ECM in TM cells may lead to fibrosis, which is known to play an important role in IOP regulation.⁶² We found that NR treatment inhibited the expression of FN, which indicates that NR prevents TGF-β2–induced fibrosis by reducing ECM deposition in HTM cells. Rao et al.^19,63 demonstrated the activation of oxidative stress in TM induced by TGF-β2, and they further identified NADPH oxidase 4 (NOX4) as the key mediator. In the early stages of TGF-β2–induced TM cell fibrosis, NOX4 expression in human TM cells is selectively upregulated by TGF-β2, inducing dysregulation of the redox equilibrium that is involved in the subsequent fibrotic responses, including ECM remodeling, filamentous actin stress fiber formation, and α-smooth muscle actin (αSMA) expression. Therefore, NOX4 is a potential target for NR-regulated oxidative stress and fibrosis in TM cells and requires further investigation. 

Taken together, our findings show that NR can ameliorate H₂O₂-induced oxidative damage in HTM cells, inhibit apoptosis, reduce ROS production, and increase the MMP, which may be related to the MAPK and JAK2/Stat3 pathways. We found that NR may have had a potential antifibrotic effect on TGF-β2–treated HTM cells (Fig. 7). These findings provide further data regarding potential therapy using NAD⁺ precursors in glaucoma. However, our study is limited as it was performed in vitro using transformed cell lines, so further studies must be performed in primary cultures and in vivo. Moreover, future studies should focus on further clarifying the mechanism related to the antifibrotic effect of NR and the relationship between oxidative stress and fibrosis in NR-regulated TM injury. 

Acknowledgments

The authors thank Junjin Lin and Shuping Zheng from the Public Technology Service Center (Fujian Medical University, Fuzhou, Fujian, China) for their technical assistance. 

Supported by grants from the National Natural Science Foundation of China (82271079, 82301194, 81970789), Natural Science Foundation of Fujian Province (2021CXA021), Startup Fund for Scientific Research of Fujian Medical University (2022QH1056), and Fujian Provincial Clinical Medical Research Center of Eye Disease and Optometry (YK-YJZX). 

Disclosure: Y. Zeng, None; Y. Lin, None; J. Yang, None; X. Wang, None; Y. Zhu, None; B. Zhou, None